Zakażenie gronkowcem u kotów



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Zakażenie gronkowcem u kotów i psów jest powszechne, a najważniejszymi patogenami kotów i psów są odpowiednio *Staphylococcus pseudintermedius* i *Staphylococcus aureus*. Inne gatunki *Staphylococcus*, a mianowicie *Staphylococcus haemolyticus*, *Staphylococcus schleiferi*, *Staphylococcus xylosus* i *Staphylococcus delphini*, również zgłaszano jako czynniki wywołujące zakażenia gronkowcami u kotów i psów, z *S. xylosus* będący gatunkiem dominującym [[@r5], [@r11], [@r23]]. Gatunki *Staphylococcus* obecne w medycynie weterynaryjnej dzielą się na gatunki koagulazo-dodatnie i koagulazo-ujemne *Staphylococcus* (CoPS i CoNS). Do głównych patogennych gatunków CoPS należą *S. pseudointermedius* i *S. złocisty*. *Gronkowce* spp. mogą być identyfikowane i klasyfikowane przez barwienie metodą Grama, a gatunki można identyfikować na podstawie morfologii metodą barwienia metodą Grama i barwienia barwnikiem specyficznym dla DNA. W weterynarii identyfikacja bakterii jest często przeprowadzana za pomocą zautomatyzowanego systemu VITEK 2 (BioMérieux, Marcy-l'Étoile, Francja) i jonizacji laserowej z desorpcją wspomaganą matrycą - spektrometria masowa czasu przelotu (MALDI-TOF-MS) . Obie te metody mają wady rutynowej analizy bakteriologicznej próbek klinicznych, a hodowla szczepów bakteryjnych jest nadal wymagana. Ponadto identyfikacja tymi metodami wymaga dodatkowych kroków i czasu. Dlatego konieczne jest opracowanie nowych metod molekularnych do szybkiej i dokładnej identyfikacji gatunków gronkowców.

W tym badaniu podjęliśmy próbę identyfikacji izolatów CoPS z próbek klinicznych przy użyciu barwnika specyficznego dla DNA, SYTO 9. Celem badania było ustalenie, czy można opracować niezawodną, ​​szybką i prostą metodę identyfikacji przy użyciu SYTO 9.

Badanie zostało zatwierdzone przez instytucjonalną komisję ds. etyki zwierząt (numer zatwierdzenia: 2017-099).

Metodę przeprowadzono w następujący sposób. Gatunki *Staphylococcus* zaszczepiono bulionem tryptozowo-sojowym (TSB) i hodowano przez 18 godzin w temperaturze 37°C. Zaszczepiony bulion zmieszano z 20 mM kwasem etylenodiaminotetraoctowym (EDTA), a próbkę przemyto i odwirowano przy 3000 obr./min przez 10 min. Supernatant odrzucono, a osad komórek zastosowano jako matrycę do barwienia SYTO9. Osad komórkowy zawieszono w roztworze barwiącym SYTO 9 (rozcieńczenie 1:500 SYTO 9 w 10 mM buforze Tris z 2 M sacharozą, pH 7,2). Zawiesinę następnie inkubowano w ciemności w temperaturze pokojowej przez 30 min. Zawiesinę wirowano przy 3000 rpm przez 10 min, a supernatant odrzucono. Osad komórkowy zawieszono w 10 mM buforze Tris, pH 7,2. Zawiesina została następnie użyta jako próbka do analizy MALDI-TOF-MS lub VITEK 2.

Gatunki *Staphylococcus* zostały zidentyfikowane na podstawie ich kolonii oraz morfologii i właściwości biochemicznych metodą barwienia metodą Grama. Do identyfikacji gatunku wykorzystano łącznie 20 gatunków *Staphylococcus*, które zostały wyizolowane z próbek klinicznych, w tym CoPS (*S. intermedius*, *S. epidermidis*, *S. schleiferi* i *S. xylosus*), ConNS (*S. aureus*, *S. delphini* i *S. equorum*) oraz ConNS z β-laktamazą (*S. capitis*, *S. haemolyticus*, *S. sciuri* i *S. xylosus* ) ([Tabela 1](#tbl_001){ref-type="table"}Tabela 1. Zestawy starterów używane w amplifikacji PCR do wykrywania określonych gatunków *Staphylococcus**Staphylococcus* gatunkówPrimerSequence (5′--3′)Wielkość amplikonu ( bp)Odniesienie*S.intermedius*SIS_1041CAGCTGATAGGAGGAACGCATCCTTCACCGAAATCGGCACGTT

CACGCAGGACAAATCCGTGTAGTTCACCAGTCTAGGC

TTGCTACGGAAACGGGATTTG

GCAAGAAAGACCCTACCTCAA

CTTGGCCTGTACACATGGCATC

CGACGCAAGCCACTTCCATTC

GCAAGACCGTGAAAGATATGGCGT

GATCAGTGCGTGTTCCATGAAGC

TGCCTCTATATCAGCCAAATGTCA

CGCAGAAGGCGGCACGGCGATG

GAGAGCGGCAGCTCCGGTGTGG*S. naskórek*SEIS_1021CTGATTTGGACCTAAATGGCGAGGAAGCAGTTGAAACGAATT

CTGCCCGTCTCCATGCCATCT

CAAACGAGACGAGTATGCTG

AGCCTGTTCTTCTGTCCTTCAC

TTTATTTGCTACGGCATGCAT

CCTCCTTCTACATGCTGGAGG

GTAGCGGTGCACATGCTTGCC

GTCTCCACACCTCGTATGAGC

AGGCTTGCAGCTCCTTTGACAG

ATCATTCACCCAGGGTTCTGG

CCCTATCGTTGTCAGCCCCGG

ATTTTTT


Obejrzyj wideo: Schedeloperatie ter correctie van het voorhoofd en de oogkassen


Uwagi:

  1. Bicoir

    Radzę odwiedzić witrynę, na której jest wiele artykułów na ten temat.

  2. Oeneus

    Czy to żart?

  3. Cuuladh

    Masz absolutną rację. W tym jest myślę, że jest to doskonały pomysł.



Napisać wiadomość


Poprzedni Artykuł

Czy fretki mogą używać żwirku dla kota?

Następny Artykuł

Dlaczego mój kot dyszy jak pies?

Video, Sitemap-Video, Sitemap-Videos